RSS

Tag Archives: technology

One base at a time…

In 1977 Fred Sanger’s lab developed a method for determining the DNA sequence of short fragments. I touched on this briefly in a prior post published here at the time of Dr. Sanger’s death.

Over the subsequent decades the technique was refined and eventually transformed into a single-tube automated reaction, however the basic method remains the same. There are three basic principles that underlie the Sanger dideoxy DNA sequencing method.

The first principle is that DNA is sequencing is a modified replication reaction that occurs whenever a cell divides. This is accomplished by stringing nucleotides together according to the original DNA molecule used as a template.  For a brief review of this replication reaction, see the animation below from HHMI.

http://www.hhmi.org/biointeractive/dna-replication-advanced-detail

The second principle is gel electrophoresis, the use of acrylamide gels to separate DNA strands based on their length. Acrylamide forms a weblike polymer sieve through which molecules (like DNA) can move. Because larger molecules get hung up on the threads of this web more often than smaller molecules do, the larger ones cover less distance in the same amount of time. Also, because DNA has a uniform negative charge spread out along its length, when an electrical current is run through the gel, the DNA will migrate toward the positive pole. If the acrylamide is made at just the right density, the DNA fragments can be separated to such precision that single base differences in length are distinguishable.

In the animation below, four tubes are prepared, each with fragments of one size. These are loaded into ‘wells’ in an acrylamide gel and then subjected to an electrical current.

The second principle comes from the nature of DNA itself and the chemistry of the nucleotides that make it up.

DNA is a long polymer made up of many nucleotides. The name, DNA, stands for deoxyribose nucleic acid, which describes the molecule chemically. The prefix ‘de-‘ means that DNA nucleotides lacks something that standard ribonucleic acids have. The ‘oxy’ part tells us what is missing, an hydroxyl (-OH) group. (See figure below) The first hydroxyl group is the one that determines the difference between DNA and RNA.

 Image

A ’di-deoxy’ molecule lacks an additional hydroxyl group (dideoxy= two hydroxyls missing)

Image

This second hydroxyl is removed from a position that forms the backbone of the molecule and is required for the next nucleotide to attach in a polymerization reaction. Without this, DNA replication comes to a screeching halt. If a sequencing reaction, which is a form of a polymerization reaction, includes a portion of these dideoxynucleotides, then the incorporation of this nucleotide will terminate the reaction at a known base.

Because DNA is comprised of the four bases, (A)denine, (T)hymine, (C)ytosine and (G)uanine, deoxynucleotides with each of these four bases are required for DNA synthesis. If a synthesis reaction is supplied all four of these in amply supply, then synthesis will proceed smoothly. If one of these is omitted and replaced with only the dideoxynucleotide version, then synthesis will proceed until that dideoxynucleotide is incorporated. Because this nucleotide lacks the hydroxyl group required to attach a subsequent nucleotide, the reaction stops.

This doesn’t give us much information, however, because we can only read up to the first of each type (A,T,C or G). What is done then, is that all four deoxynucleotides are supplied, but in each of four tubes, a small proportion of dideoxynucleotides is added. In this way, the synthesis reactions can proceed until a dideoxynucleotide is added, but this may happen at a different occurrence of this nucleotide in each instance of synthesis.

Consider the template sequence below in black. Replicative strands are made using deoxyribonucleotides (in black) and dideoxy-A (in red).

AGTCTCGATGCTAATGCATGpartial gel

A

AGTCTCGA

AGTCTCGATGCTA

AGTCTCGATGCTAA

AGTCTCGATGCTAATGCA

When these fragments are run on a gel, we can visualize a band at positions corresponding to the occurrence of each ‘A’ nucleotide in the sequence.

In the same way, three additional reactions are run including dideoxynucleotides of each flavor and then run on separate lanes of the gel. Altogether, these four lanes provide a complete account of the original DNA sequence.

full gel

 
Leave a comment

Posted by on December 18, 2013 in Uncategorized

 

Tags: , , , , , , ,

Why is this the image the public has of biotech?

Image

I don’t recall ever seeing these plants growing in the fields I pass on my way to work

The biotech revolution can easily be traced even before the publication of Watson and Crick’s landmark Nature paper describing the structure of DNA with clear tracings to Avery, McCarty and MacLeod; Hershey and Chase; Frederick Griffith and others. However, it has become a simple shorthand to start the journey with these two working in the Cavendish Laboratories in Cambridge, England. Their remarkable tale is somewhat like the silicon valley stories of massive industries sprouting up from the garages of Jobs and Wozniak, Gates or Hewlett and Packard. Almost without a detectable ember, a sudden fire erupts changing the landscape of the world.

DNA is a double helix composed of anti-parallel strands of chemically simple nucleic acids joined by millions of low energy hydrogen bonds – two between Adenine (A) and Thymine (T), three between Cytosine (C) and Guanine (G).

Image

Way to lock in a second paper

With this last sentence before their acknowledgements, they make a very reasonable and supremely important speculation about the mechanism of replication indicating that the race was far from over. Rather than being the finish line, this paper was only the beginning of a wealth of information to be gleaned about the mechanisms by which DNA is actually used to carry information and direct the construction of RNAs and Proteins that translate this information into action.

Image

Using EcoRI to move DNA sequences from one place to another ( or one organism to another)

Twenty years later work by Paul Berg, Herbert W. Boyer, and Stanley N. Cohen, to actually manipulate DNA, moving genes from one organism’s genome to another’s, marked another giant step. Their work with the Endonuclease (enzyme that cuts DNA internally), EcoRI, provided the first major tool for the biotech industry. This enzyme allowed researchers to cut DNA at a very specific place (at the sequence, GAATTC) and in a very specific way (leaving overhanging ends that could later be re-annealled with other DNA fragments cut by the same enzyme).

The advent of this technology accelerated research greatly as labs could now isolate and control for the actions of single genes and therefore greatly refine their ability to craft clean experiments to study the effects of these genes.

Today there are dozens of these enzymes (New England Biolabs (NEB) sells 276 different enzymes), known as restriction enzymes, that can be used to specifically cut and paste DNA with precision.  Below is a map of a common plasmid (a small piece of circular DNA that bacteria can easily take up and replicate). Each possible cut site is labelled with the enzyme that can cleave the DNA at that location. Shown are only the enzymes that NEB sells.

Image

A restriction map of the plasmid, pBR322

The only thing lacking was a method for specifically amplifying single genes from an organism’s DNA. This could be done, but the process was laborious and time consuming. Enter Kary Mullis (you might recognize the name from the OJ simpson trial in the 1990s if you are over a certain age). He was a biochemist and computer programmer working for Cetus Corporation when he had an epiphany while driving down the road, stopped and quickly mapped out an idea to amplify DNA using temperature cycling and a special enzyme cocktail that would later earn him a Nobel Prize.

The combination of his biotech background and the ability to think in the loops of a programmer enabled him to see the method illustrated below, which he called a Polymerase Chain Reaction (PCR). This used small DNA ‘primers’ that could be synthesized in high numbers in the laboratory, to specifically bracket an expanse of DNA. Cycling the temperature of the reaction stood in for the enzymatic zipping and unzipping of DNA that permitted these primers to bind to their target sequences. Then adding a polymerase enzyme and free nucleotides, provided all that was required to do in vitro DNA replication that was repeated several times (typically 20-40x) to exponentially amplify only the specific target sequence of DNA so that it could be isolated on a gel and manipulated.

Image

PCR amplification of a target gene

Image

Gel electrophoresis – separation of DNA by size. Here DNA ‘ladders’ are run on lanes 1 and 6 to indicate the size of the DNA fragments, lane 5 is a negative control and lanes 2-4 are PCR amplifications of a specific gene.

DNA fragments run on an agarose gel can be easily isolated (by cutting them free from the gel and chemically purifying them) and used in any of a number of downstream processes such as cutting them and pasting them into another organism’s genome (or more commonly, into another plasmid where they can be moved from organism to organism.)

Applications of this technology include the ‘cloning’ of human insulin from human DNA and moving it into a organism like yeast or bacteria, where these genes can be turned into protein for human use.

This allows for the high-yeild production of these specifically human proteins in a laboratory setting, rather than the old way of bleeding pigs and isolating porcine insulin for use in humans.

Of course, Recombinant DNA technology is like any other technology. A knife can be used to slice bread or as a weapon against another human being. However, it does seem awfully unfair to jump from medicinal uses to ‘The little shop of horrors’ in one leap while condemning everyone who has anything to do with the work along the way.

 
Leave a comment

Posted by on November 20, 2013 in Uncategorized

 

Tags: , , , , , , , , , , ,

Teaching Coding, from the ground up

ImageA new program in Estonia is introducing students from the earliest grades and keeping them involved in coding throughout their school career. The program, The ProgoTiiger Initiative, is spearheaded by Ave Lauringson. last week, Grace Conyers, a blogger at AAAS sat down and spoke with Ms. Lauringson about the program. You can find the transcript of their conversation on the AAAS site. Please go and check this article out.

 
Leave a comment

Posted by on March 25, 2013 in Uncategorized

 

Tags: , , , , , , ,

Students

I invited my students to view this site – specifically, this is in order to get access to the class summaries that I have been posting here. I wondered for a while whether this would be a good idea or not. But n the end, I realized that I don’t publish anything here that I don’t want someone to see. In fact, considering the random things I post, I wonder if any of them would actually even read beyond those essays that directly describe class.

That said, I’m interested to see if any students actually do check in. So, if you’re from my class, please click on comment and say hello.

 

 
8 Comments

Posted by on September 6, 2012 in Uncategorized

 

Tags: , , , , ,

Teachers, do you blog for your students?

I’ve been wondering…

On this blog, I’ve been posting how my biology class is going each day and summarizing what I attempted to teach. Thus far, I have not told my students that I have this blog. Do any of you who teach have your students read your blog? I’ve considered it, but if I did, it would mean that I should be extra careful about what I say. Of course I don’t ever mention specific students here – in fact, I try not to talk about them much at all. I’d prefer to just talk about my experience and what I want them to take home…. but, it is something to consider.

Image

Blogging for the classroom?

So, do any teachers out there blog?

 

 

 
Leave a comment

Posted by on August 31, 2012 in Uncategorized

 

Tags: , , , , , ,

Intro Bio -Day 1

The first class of Intro Biology was yesterday and perhaps I was a bit too … familiar.

I’ve been teaching this class for a number of semesters now and my preparation time has gone down to a minimum – not to say that I don’t prepare, in fact, I prepare quite a lot. That said, I think more about what major concepts I want to get across during a class and don’t worry as much about the small stuff. Because the first day doesn’t have that much to it anyway, I know I could have structured my day a little better.

Instead, I may have come on fairly strong – piping at full steam under the power of a towering cup of cafe americano.

Here’s the structure of Day 1:

Sign in, pick up packets and go through the syllabus.

I also spend some time showing off the iBook I put together as a student handbook and explain how these will all be available as interactive software on the school’s iPads (oooohhh. – I think I was the only one impressed)

That is biology?  – The study of life.

What is it to be alive? – Harder to put into words than you would guess.

But it can be estimated by a series of characteristics and something called Cell Theory.

And Cell Theory, by the way, is one of the central concepts of biology.

What are the others?

Germ theory – some micro-organisms cause some diseases (a direct derivative of cell theory) Can be demonstrated by following Koch’s Postulates. Discuss some examples and then shelf – Germ Theory is the focus of my entire microbiology class, we don’t discuss it much in general bio after the first couple days.

The Central Dogma – DNA –> RNA –> Protein

Information –> molecules that carry out work

Inheritance and Evolution – How is information passed from one generation to the next. How do the mechanics of this work and what does that demonstrate about the history of life.

Follow up with how science is actually nothing but a systematized way of asking questions of nature  – play an excerpt from the Mischel’s Marshmallow’s episode of the RadioLab podcast (http://www.radiolab.org/blogs/radiolab-blog/2009/mar/09/mischels-marshmallows/). I cut off right after Jonah Lehrer cuts in saying that the difference in SAT scores is 200 pts+ for kids who can exhibit self control at an early age. Then we talk about what the question was, what the data was, how it was interpreted and what subsequent hypotheses can be suggested.

Actually, it all sounds quite reasonable here, but I might have just presented it a bit too frenetically. I actually get so excited about teaching that I have trouble containing myself. Especially after a whole summer of having no ‘audience’ – I need my stage-time!

So that was day 1. I’m only teaching one section this semester and I’m realizing that it’s not enough! Damn. They offered me more and I refused it. Ughhh. Well, the life of an adjunct. If they’d offer me a fulltime position it would be different.

An aside:  There is a part of me that agrees with my former mentor’s philosophy that if you come down on them and make the class a challenge right out of the gate, then you never have to deal with the chaff at all and you get nothing but the best students coming back.

There’s another part of me that thinks (perhaps unjustly) that, “yes -but you’re teaching ivy league students taking advanced immunology. I’m teaching a intro biology to a jr. college class.”

 
4 Comments

Posted by on August 22, 2012 in Uncategorized

 

Tags: , , , , , , , , , ,

iShakespeare

I don’t want to repeat myself, but I just read a couple of interesting articles about a new app that brings Shakespeare’s play ‘The Tempest’ come to life.

Check out the posting on my technology in the classroom blog, app campus.wordpress.com

 
Leave a comment

Posted by on August 17, 2012 in Uncategorized

 

Tags: , , , , , , , ,

The word ‘desertification’ keeps coming to mind

Here I am moaning and complaining about the weather again. But I just can’t stand these deathly hot, dry days one after another after another.

I’m reminded of a Star Trek Next Generation episode where Captain Picard wakes up in another man’s life. In this life he’s married and a naturalist who discovers that his planet is suffering from a world-wide drought and, in fact, this life experience is a window into the culture of an extinct world. This isn’t a very good explanation – check it out yourself. The episode is called “Inner Light.”

Please don’t let this drought be the Midwest’s Inner Light. At least not while I’m living here.

 

OK, in other news, I just posted another article to AppCampus about how I think video games can be harnessed to improve education in the sciences (or perhaps any subject).

I also need to put together the work we did here on the Blackjack program (codecademy project) into a neat posting for that site’s message board. I think the whole code with sufficient notation and some commentary should be a valuable contribution there.

 

Image

 
Leave a comment

Posted by on July 31, 2012 in Uncategorized

 

Tags: , , , , , ,